• Welcome to DOSBODS

    Please consider creating a free account to be able to access all the features of the DOSBODS community. It only takes 20 seconds!

Sign in to follow this  
sarahbell

these dna twats. tests. autocomplete did that

Recommended Posts

9 minutes ago, sarahbell said:

friend had dna test thing and it's come back she is mostly british. unlike some others i've seen boasting about how mixed theirs is.

can anyone get hold of muntjac dna? https://ipfs.io/ipfs/QmXoypizjW3WknFiJnKLwHCnL72vedxjQkDDP1mXWo6uco/wiki/List_of_organisms_by_chromosome_count.html

 

would they know it wasn't human?

Well you could check for them if they'll give you the sequence, this is how

Copy the sequence in the quote below and paste it into the box at the top left of the following NCBI webpage where it says Enter sequence. Then, click BLAST at the bottom left (Click the check box 'open in a new window'). In the new window, click on any of the links in the description. Do the same with your friends DNA sequence to find out if they are a muntjac

NCBI webpage

Quote

gtgccagcagccgcggtaattccagctccaatagcgtatattaaaattgttgcagttaaaaagctcgtagttgaatttctgctgtattgtaatttctcctatacgagtttttacattatggcttatttcggtattaaatttattttattaccggatgtttactttgagaaaattagagtgctcaaagcaggcttttgccttgaatagtttagcatggaataataaagtaggactttggttctattttgttggttttaggtaccaaagtaatggttaataggaacagttgggggcattcgtatttaactgtcagaggtgaaattcttagatttgttaaagacgaactactgcgaaagcatttgccaaggatgttttcattaatcaagaacgaaagttaggggatcgaagacgatcagatac

 

Share this post


Link to post
Share on other sites

Parents did this out of curiosity, Mother 100% North European/Scandinavian i.e. British, Father 99% the same, 1% Turkish.

Therefore I am 99.5% British and 0.5% Turkish, hopefully in another 5 generations that can be corrected.

Share this post


Link to post
Share on other sites
2 minutes ago, Chewing Grass said:

Parents did this out of curiosity, Mother 100% North European/Scandinavian i.e. British, Father 99% the same, 1% Turkish.

Therefore I am 99.5% British and 0.5% Turkish, hopefully in another 5 generations that can be corrected.

May I ask, where did they do this and how much did it cost?

There are some rumours in my family that would be fun to check out!

Share this post


Link to post
Share on other sites
5 minutes ago, sarahbell said:

i think ancestry

friend's showed four fourth cousins as possible relations already tested,

I don't want any more relatives! The ones I have already are bad enough :(

Share this post


Link to post
Share on other sites
3 minutes ago, sarahbell said:

Connect with relatives you never knew you had.

Once you've taken your test, we'll search our global network of AncestryDNA members and identify the people who share your DNA. There's no limit to what you might discover—together.

They don't give any way for people to contact you do they?

I'm under cover, you wouldn't believe what my relatives have done, I avoid them like the plague :D

12 minutes ago, Chewing Grass said:

Many thanks :)

Share this post


Link to post
Share on other sites

My father did the family tree and coupled with our sirname we have probably managed to migrate about 15 miles in 1000 years.

Car ownership has accelerated our movement outwards with our eldest now pushing the boundary up by another 5 to 20 miles.

If you want indigenous we are about as indigenous as it gets in the UK, we should have 1st nation status and a reserve.

Share this post


Link to post
Share on other sites
1 minute ago, Chewing Grass said:

My father did the family tree and coupled with our sirname we have probably managed to migrate about 15 miles in 1000 years.

Car ownership has accelerated our movement outwards with our eldest now pushing the boundary up by another 5 to 20 miles.

If you want indigenous we are about as indigenous as it gets in the UK, we should have 1st nation status and a reserve.

You'll be wanting to read this then,

The United Nations Declaration of the Rights of Indigenous Peoples  :)

DRIPS_en.pdf

Share this post


Link to post
Share on other sites
26 minutes ago, Chewing Grass said:

My father did the family tree and coupled with our sirname we have probably managed to migrate about 15 miles in 1000 years.

Car ownership has accelerated our movement outwards with our eldest now pushing the boundary up by another 5 to 20 miles.

If you want indigenous we are about as indigenous as it gets in the UK, we should have 1st nation status and a reserve.

Get yourselves down the cryochamber. 

s-l1000.jpg

Share this post


Link to post
Share on other sites
1 hour ago, Chewing Grass said:

Parents did this out of curiosity, Mother 100% North European/Scandinavian i.e. British, Father 99% the same, 1% Turkish.

Therefore I am 99.5% British and 0.5% Turkish, hopefully in another 5 generations that can be corrected.

That's the problem with these things, Turkey didn't exist back when you got that 0.5%. Turkic maybe, safer to say central Asian, or do they just mean Middle Eastern, or is it random noise? Who knows

Edited by Panther

Share this post


Link to post
Share on other sites
49 minutes ago, Chewing Grass said:

My father did the family tree and coupled with our sirname we have probably managed to migrate about 15 miles in 1000 years.

Car ownership has accelerated our movement outwards with our eldest now pushing the boundary up by another 5 to 20 miles.

If you want indigenous we are about as indigenous as it gets in the UK, we should have 1st nation status and a reserve.

Send the buggers back!

Send the buggers back!

Share this post


Link to post
Share on other sites

There is evidence online of staff at genetic testing labs inserting african/other percentages because they want to mess with 'racist' whites perceptions.  They say they put <1% as zero is technically <1%.

 

So if your relative had <1% turkish, that could mean zero.

 

Share this post


Link to post
Share on other sites
6 minutes ago, wherebee said:

There is evidence online of staff at genetic testing labs inserting african/other percentages because they want to mess with 'racist' whites perceptions.  They say they put <1% as zero is technically <1%.

 

So if your relative had <1% turkish, that could mean zero.

 

There is evidence online

 

 

 

 

 

 

but no link provided xD

 

absolute fucking classic/now have to mop up beer from my laptop

 

Share this post


Link to post
Share on other sites
4 minutes ago, Knock Out Johnny said:

There is evidence online

 

 

 

 

 

 

but no link provided xD

 

absolute fucking classic/now have to mop up beer from my laptop

 

sigh.  I was making a cup of tea so could not be arsed to find the source.

 

here you go.

 

http://www.cracked.com/personal-experiences-2522-inside-shady-world-dna-testing-companies.html

Share this post


Link to post
Share on other sites
55 minutes ago, wherebee said:

sigh.  I was making a cup of tea so could not be arsed to find the source.

 

here you go.

 

http://www.cracked.com/personal-experiences-2522-inside-shady-world-dna-testing-companies.html

Yep just as I thought - cobblers

https://www.snopes.com/dna-testing-companies-admit-altering-tests-screw-racists/

Although headlines suggested “DNA testing companies” admitted they routinely tampered with customers’ results and articles hinted that that fudging exceeded 10 percent, the claim was based on a humor web site’s interview with an anonymous purported employee.

Not only were the claims unvetted, but they are only alleged to have affected a sum total of two customers.

Edited by Knock Out Johnny

Share this post


Link to post
Share on other sites

Snopes is one of those dangerous American organisations that hijacks a particular area of information/data in order to be a monopoly provider. It is the 'truth' equivalent of Getty images.

If you want to know the truth take some time and effort to work it out yourself, if you don't you may as well live in Stalins Russia or Hitlers Germany.

Unfortunately most young people today (the internet/iphone generation) are just too lazy, too trusting, and too clueless to bother.

As most young folks don't pay for anything if they can help it Snopes is like a newspaper (probably like the Guardian).

From Snopes:- 'The Snopes.com web site is (and always has been) a completely independent, self-sufficient entity wholly owned by its operators and funded through advertising revenues.'

So in other words Snopes is exactly like Youtube, trades on its past reputation (from the early days i.e. the journalists who use its youth) but is reliant on Advertising Revenue and is therefore potentially compromised.

Share this post


Link to post
Share on other sites
32 minutes ago, Chewing Grass said:

Snopes is one of those dangerous American organisations that hijacks a particular area of information/data in order to be a monopoly provider. It is the 'truth' equivalent of Getty images.

If you want to know the truth take some time and effort to work it out yourself, if you don't you may as well live in Stalins Russia or Hitlers Germany.

Unfortunately most young people today (the internet/iphone generation) are just too lazy, too trusting, and too clueless to bother.

As most young folks don't pay for anything if they can help it Snopes is like a newspaper (probably like the Guardian).

From Snopes:- 'The Snopes.com web site is (and always has been) a completely independent, self-sufficient entity wholly owned by its operators and funded through advertising revenues.'

So in other words Snopes is exactly like Youtube, trades on its past reputation (from the early days i.e. the journalists who use its youth) but is reliant on Advertising Revenue and is therefore potentilly compromised.

Yeah let's go with info wars and Paul Watson because that confirms my beliefs. 

Is snopes infallible? of course not but I'll take it over the risible daily mail who are the original source for the Forbes article. 

That's right The Daily Fucking Mail

Now go and sit on the naughty step for 5 minutes

The Daily Mail. 

 

 

I can see that everyone here is fucking desperate to be the progeny of Rufus the Redhead and Boudica but this place reads like Stormfront on occasion

 

Actually it's worse than Stormfront as they bang on about the importance of being white; here it's to prove your entire gene pool Is reduced to a 50 mile radius. Mental. 

Edited by Knock Out Johnny

Share this post


Link to post
Share on other sites
6 minutes ago, Knock Out Johnny said:

Now go and sit on the naughty step for 5 minutes

 

PS. I wasn't refering to you knob-out.

I was just saying everyone should work things out for themselves, obviously this may not tie in with your southern metropolitan world view but thats your micro-environment and not mine.

You've just put yourself back in the pidgeon hole.

Share this post


Link to post
Share on other sites
11 minutes ago, Chewing Grass said:

 

PS. I wasn't refering to you knob-out.

I was just saying everyone should work things out for themselves, obviously this may not tie in with your southern metropolitan world view but thats your micro-environment and not mine.

You've just put yourself back in the pidgeon hole.

And I just said that you shouldn't rely on the Daily Mail for investigaive groundbreaking journalism

 

 

Pigeonhole?

I know I'm reviled on here - pixels from strangers. 

Edited by Knock Out Johnny

Share this post


Link to post
Share on other sites

The Daily Mail is a combination of sewer journalism, tits dressed up as fashion, and true stories other media outlets won't cover.  The trick is working out which is which.

 

And KOJ - you are not reviled mate, far from it.  Every commentator is welcome.

Share this post


Link to post
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now
Sign in to follow this  

  • Similar Content

    • By spunko
      Did anyone watch this programme on the So-Called BBC last night? It was a confusing mess.
      The gist of it was that Michael Stone, a man with psychological issues, was sent down under dodgy evidence for murdering a Kent family with a hammer, but Levi Bellfield (Millie Dowler murderer) is likely believed to be the real murderer. Some suggestions that the Police have been inept - no surprise.
      There is allegedly some DNA left on a towel that was used to strangle the family, which doesn't belong to Stone but another man. The production team (or someone otherwise involved with the case) wrote to Bellfield to request his DNA to remove him from their investigations; he initially complied but then went quiet. Hmmm..
      I have been reading about it today and cannot fathom why the police/CPS cannot apparently forcefully obtain the DNA from a convicted murderer - presumably they have it already anyway?  I don't know the ins-and-outs of the justice system, but surely they have his DNA and can rule him out.
       
      This is why I don't watch documentaries much now, you waste an hour of your life when they don't answer any of the questions they pose, and you can just read up on it on Wikipedia in 2 minutes.
       
  • Recently Browsing   0 members

    No registered users viewing this page.